Property talk:P4863

Documentation

• Start a query
• Current uses
• Statistics by class
• String length
• List of qualifiers
• Count

recognition sequence
DNA sequence recognized by a restriction enzyme, DNA binding domain, etc, written from 5' to 3'

Represents	recognition sequence (Q7302658)
Data type	String
Domain	restriction enzyme (Q219715)
Allowed values	According to this template: [ACGTRMWSYKHBDVN]+; using standard abbreviations (see w:Template:LORECSListAminoAcids and REBASE help) According to statements in the property: [ACGTRMWSYKHBDVN]+ When possible, data should only be stored as statements
Example	EcoRI (Q417754) → GAATTC
See also	cutting site of restriction enzyme (P4864), isoschizomer (P4873), neoschizomer (P4875)
Lists	Items with the most statements of this property Count of items by number of statements (chart) Items with the most statements Items with the fewest statements Count of items by number of sitelinks (chart) Items with the most sitelinks Items with the most sitelinks, but no link to one Wikipedia (sample: Welsh Wikipedia, cywiki) Items with the fewest sitelinks Most linked wikis Items with the most identifier properties Items with no other statements Most recently created items Items with novalue claims Items with unknown value claims Usage history (total) Usage history (main statement) Chart by item creation date Database reports/Constraint violations/P4863 Map Random list
Proposal discussion	Proposal discussion
Current uses	Total 1,574 Main statement 1,572 99.9% of uses Qualifier 1 <0.1% of uses Reference 1 <0.1% of uses
Search for values

[create Create a translatable help page (preferably in English) for this property to be included here]

Type “restriction enzyme (Q219715)”: item must contain property “subclass of (P279)” with classes “restriction enzyme (Q219715)” or their subclasses (defined using subclass of (P279)). (Help)

Exceptions are possible as rare values may exist. Exceptions can be specified using exception to constraint (P2303).
List of violations of this constraint: Database reports/Constraint violations/P4863#Type Q219715, SPARQL

Format “[ACGTRMWSYKHBDVN]+”: value must be formatted using this pattern (PCRE syntax). (Help)

List of violations of this constraint: Database reports/Constraint violations/P4863#Format, hourly updated report, SPARQL

Scope is as main value (Q54828448): the property must be used by specified way only (Help)

List of violations of this constraint: Database reports/Constraint violations/P4863#Scope, hourly updated report, SPARQL

Example SPAPQL query

You can search restriction enzymes which can recognize the sequence "ACTTGTCATGGCGACTGTCCAGCTTTGTGCCAGGAGCCTCGCAGGGGTTG", for instance, and its cutting site by using regex FILTER (modified from [1]).

SELECT DISTINCT ?enzyme ?enzymeLabel ?recognize ?cut
WHERE
{
  ?enzyme wdt:P31 wd:Q49695242;
          rdfs:label ?enzymeLabel;
          wdt:P4863 ?recognize;
          wdt:P4864 ?cut;
  FILTER (lang(?enzymeLabel) = "en") .
  FILTER regex ("ACTTGTCATGGCGACTGTCCAGCTTTGTGCCAGGAGCCTCGCAGGGGTTG", ?recognize) 
}

Try it!