Wikidata:Database reports/Constraint violations/Mandatory constraints/Violations

From Wikidata
Jump to navigation Jump to search

route map (P15): Format[edit]

image (P18): Commons link[edit]

place of birth (P19): Conflicts with instance of (P31)[edit]

sex or gender (P21): Conflicts with located in the administrative territorial entity (P131)[edit]

sex or gender (P21): Conflicts with instance of (P31)[edit]

sex or gender (P21): Conflicts with original language of film or TV show (P364)[edit]

sex or gender (P21): Conflicts with coordinate location (P625)[edit]

sex or gender (P21): One of[edit]

mother (P25): Allowed qualifiers[edit]

child (P40): Conflicts with instance of (P31)[edit]

flag image (P41): Format[edit]

noble title (P97): Type human (Q5), legendary figure (Q13002315), fictional character (Q95074), narrative entity (Q21070598)[edit]

occupation (P106): Conflicts with instance of (P31)[edit]

home venue (P115): Contemporary[edit]

place of burial (P119): Conflicts with instance of (P31)[edit]

located in the administrative territorial entity (P131): Conflicts with instance of (P31)[edit]

logo image (P154): Format[edit]

followed by (P156): None of[edit]

seal image (P158): Commons link[edit]

developer (P178): Contemporary[edit]

doctoral advisor (P184): Value type human (Q5), fictional human (Q15632617)[edit]

doctoral student (P185): Value type human (Q5), fictional human (Q15632617)[edit]

adjacent station (P197): Item country (P17)[edit]

adjacent station (P197): Type entry point (Q228332)[edit]

VIAF ID (P214): Allowed qualifiers[edit]

VIAF ID (P214): Conflicts with instance of (P31)[edit]

ISO 639-1 code (P218): Item ISO 639-2 code (P219)[edit]

ISO 639-1 code (P218): Item ISO 639-3 code (P220)[edit]

ISO 639-2 code (P219): Item IETF language tag (P305)[edit]

ISO 639-3 code (P220): Allowed qualifiers[edit]

EC number (P232): Single value[edit]

canonical SMILES (P233): Allowed qualifiers[edit]

ISSN (P236): Format[edit]

FAA airport code (P240): Format[edit]

FAA airport code (P240): Single value[edit]

COSPAR ID (P247): Conflicts with coordinate location (P625)[edit]

CiNii author ID (books) (P271): Format[edit]

chemical formula (P274): Conflicts with general formula (P1673)[edit]

GOST 7.75–97 code (P278): Format[edit]

postal code (P281): Conflicts with subclass of (P279)[edit]

postal code (P281): Conflicts with instance of (P31)[edit]

head coach (P286): Value type human (Q5)[edit]

vessel class (P289): Type watercraft (Q1229765), vessel (Q16391167), fictional ship (Q16708006), fictional spacecraft (Q14637321)[edit]

station code (P296): Conflicts with ESR station code (P2815)[edit]

station code (P296): Conflicts with Gares & Connexions ID (P3104)[edit]

station code (P296): Conflicts with UK railway station code (P4755)[edit]

station code (P296): Conflicts with Amtrak station code (P4803)[edit]

station code (P296): Format[edit]

ISO 3166-1 alpha-2 code (P297): Item ISO 3166-1 numeric code (P299)[edit]

ISO 3166-1 alpha-3 code (P298): Item ISO 3166-1 alpha-2 code (P297)[edit]

ISO 3166-1 numeric code (P299): Item ISO 3166-1 alpha-2 code (P297)[edit]

ISO 3166-1 numeric code (P299): Single value[edit]

ISO 3166-2 code (P300): Format[edit]

IMDb ID (P345): Conflicts with instance of (P31)[edit]

Joconde work ID (P347): Item collection (P195)[edit]

RKDimages ID (P350): Item collection (P195)[edit]

RKDimages ID (P350): Type work of art (Q838948), artwork series (Q15709879), book (Q571)[edit]

Entrez Gene ID (P351): Single value[edit]

discography (P358): Unique value[edit]

part of (P361): Entity types[edit]

Sandbox-String (P370): Scope[edit]

  • Q65499045: Property:P370: ATGCCCGACGCCTCCTCTACCGCGGTGGTAGCCGCCCCTCCTTCCAAAGAGAGGTTGGGTAGCAGCGGAGGCGTGCTGCTACCGCTTGCCGTGGCCGGAGCTGGTCTGCTGTGCCTATGGAAGGCCTTCCAAATTTGCTCCGTTCCCGTTCACCCGCGTTGCGTGACCGTCGTCTACGACACGCGCCGCAAGACGGTCTTGTGCACCTCGGCGGATTGCGAGATGCGCCGGGGCTCACTGCCGCGGGTGTCTCACTTCAACGCGTCACTGTACTTCGGGTCCGCGCTGATGTACTGGAGCCGGACGCGGCTGCTGGTGCCGCCGTCGTCCTTCTTCGGCGTCTTCACGCTTCCGCGCAGCGTCCTCGAGGAGCCGGGCGAGCCCGTGAACTGTGCCGTGGAGGAGGTGGCCGTGCGCGACGGGTCCGTGAACATGATGGTGACTGTCTTCTACACCATCCCCTTCGACCAGGTGGAGCGCTACCTTGCCGCCGTCGGCCCTGAGCCACCGAACGAAGTAATCGGCAAGGCGGTCGCCTACGTTGCACGCGTGCGGTGCGCAGAGCAGTCGGCCGGTATCTTGCTCAGCAAGACCCGCCGCGAAGCGTTCATGGGTCCGTACAAGGACCACCTTACCTCGAAGCTCATGTCGGAGGCGGCGGTGCTGGTGAGGGACGTGGCTGTGGAGAGTGTGGTGCTGCTCGAGGGGGGCTAG
  • Q65500432: Property:P370: ATGGGCAACCAGCTTTTCCTCGTTGCAAATCTGTTAGCCACTGCGCACCGGACTGGCATCCCAGCCTACCTGGAGGCGGCGCCGTTCAGCAGCAGCGCCGAGGGCCCACGTCCCACCTACTGGGACACACTTTTTCGCGACCTCGGTCGTCACGGCGTACAGATGTGTGCGTCCTCGCCGCCGCTGCCTGTCGTGACGGTGCCCGAGACGCGACCCGTGCGGAAGGTGCGACTCGATGCGCAGCGGCCCTGCGCCTTCCACATGATCGGCTTCTTCCAAAGCGATGCCTTCTTCGACGACCACCCGATCATGTCCTCCGTCATCCCGCGGGAGCTGTGGGACTCGGCCCGCGAGCACCTGGCCACCTACTACGGCGGCGGGTCGTGCCACACTGTCGCCCTGCACGTGCGGCGTGGCGACTACACACGTTTTACCGACATCTTCGAGCAGCTCGACGTCGTCGAGTACTACGATGTGGCAGTGCGGCAGCTGCTTGGTGGCCTGCTCTTGCAGCCGCCTTCGCTGCTGCGGCCGCAGCAGTCATCGGTGGACTCGGCCCAAGCGCCGACTGCAGGCACACCGCCGCTGCTGCCGCTTCACTTGCTTGTCTTCTGCGACGAGGAGCGCTTTGGGCGCACCGTTGTGGGGTACTTCCGCACCAAGTACAAGGGTGCCGTGATGGTCAGCCTCGTGTGCGCCGCGACGGAGGCAAGCGCGATATGGGCGAGGCCAACCGCGTCGTCGCCGTCAGTGCCGATAATGCCGCGTGATGTACTGGAGTTGCTGATGATGTCGCAGTGCAACGACGTCGTGATGGCAAACTCGACCTTCTCGTGGTGGGGCGCCTACCTGAACCGCGTCTCACTGCGCCGTGTCATCGCACCGTCCCGGTGGTTCGTGAAGGATCCGTACCCGGCGTCAAATCACCTCTACTGCCCTGGATGGATACTCATCTGA
  • Q65500958: Property:P370: ATGCTGCCGTTTTCTTACCGAGTGCTCATGCGCGGCGTATCGGCGGTGGCCGGTGCGTCGTCCGTGGCTCTGCAGCATCGCGCGCTGGCGGGGACGACGCGCTCGTTCAGCAGCAGCAGCCTGGTGTGGTTGGCGCCAGCCGCGCCGACAACGCAGACGCCGCCGGCGATGGGCGGCGATACGGACGCTGAGGAGACGCACCCTGATTTTCAGCCCCGCATGGTATCCAGCGACCTCGCGCAGGACGAGATCGCCATGATCAAGAAGGATATAGACGACACAATCCGCGATGAGGACATTGTCGTGTTCATCAAGGGCGTTCCGGAGGCGCCAATGTGCGCCTTCTCGAAGCGCATGATTGACGTGATGGAGGCGCTTGGGGTGGAGTACACCTCATTCGACGTGCTCGCTCACCCGGTGGTGCGCAGCTACGTGAAGGAGGTGAGCGAGTGGCCGACGATCCCGCAGTTGTTTGTGAAGGGTGAGTTTGCCGGCGGCGTCGACATCATCCTGAAGATGGCGGAGGGCGGCGACTTGCAGATGCTGCTGGATCAGAAGGGCATCAAGCATCGTGATACCAAACCGTAG
  • Q65516655: Property:P370: ATGGCACTAACGCAGTCTTCTGGTGCGCCGCTGCGCAGTGTGCAAGGCGGCGTAGGAGATGCATCGTACGCGGATGGGGCCGGGCGGGCGCCCGGGCGCGTCAACGGGGCCTCCGCGACACCGCTGCTGACGGAGGAGGCGGTGCAGAGCAGCATTGAGACTTTCGAGGATGCGGCCTGGGTGCGGGAAGAGGCAGTGCGCAGCTACGCAGAGTTCCACAACAACGTCGAGTCGCTGCACGCAACCATGCGCACGCAACTTCGGCCTGTGTGGCGGACAGCGATGCAGCTGCGCCCTGACATCCTCGCGGATGTGCGAGACGAGTGGCGCCTCCGCCGACGTGACAGCATTCCAGACGGCATCCCGATCCCTGCCGCCGCCGCGCAGCACATCGCGCTGCAGGAGACCATACTGAGTGAAGTGGAGGACACGCTGCAGGTGCTGCGCAACACGTCGGTCCGCTTCGCCGCGCATTTCTTGTCGGATGAGGAGAAGATCTCCATGGGCGCAAACCCCGCGTACCTGCGCGCGCCGGACATAGACAAGGAAGTGGTGGTGTCGCGCTCGCAGAGCACTTCCACCTCGCCACAGCGCGCGCTGCCAGCCAGTGTGATGTCAGTTTCCTCGTCTGCAGGAGCTGTGGCGAGTGCCCACATAAAGCCTTCCGCGTCTAGTGCTGCTACTGCTGCCGTCCACACAACACGTGAGGGACACAGTCGTCGCCACCAGGGCAGCCATGCGCAGCACCACCACCACCACAACGACGACGAAGCGGGACTGGTGAGCTCCAGCTCGAACCGGCACGTGCACAGTGGCAAGTCCTCCTGTGCGAGCCGGGGCGCCGGCGACGATCCGCTGTTGGAGGAGTTGCGCAAGCAGTATCAGCTGCGCATTAGGGAACTGAAGGCGCAGTGTGAGGCGGGAGCAAGCCGTCGAAGCGAGCACGGTGCATCGCGATCAGCGGCGGCGACGCCACCGCGGCGCGGTAATCGGGCACGCGTCGCAGCGTCGAGATCATCGTCTCTACCTTCGAGGGCTTCATCGGCGTCTGCGAGTGTATTGACCAGCTCCAGCTCGACAGTGTCGCGTCGCTGA
  • Q65516997: Property:P370: ATGAAGATCACCGTTCACGTGCGAGAGAAGATCATACCGCTGCAGTGCGGCGATGGCACGCAGCAGGTGGTGTGGCTCGGTAACGCAGCCATGATACACTACGACGCTTCCTTTGGCAAGCGCTTCGGCCCGCCGGTGTCGATCCGAAAAGAGGGCGGCGTGCAGTGCGACTTTGAGGCCCGCGTGTGCGACGTGCTGGAGGATGGCCAGCACGTATTTGTGACCCTCGAGAGCGACAGGGGGCAGTAA
  • Q65517494: Property:P370: ATGGCTCTGCCGGGCGTATCACATTATGAGCGCCTGCCCACGCGTACCAAGATTCAGTTCTTCTGGATCTCCATGCTGACGATGGGCTTCGCGTACCAGTTTCTCAAGATGACGGTGCTGCGCGTGCAGCCGAAGCGAGAGGAACAGATGTACATGCACATCCGAAAGGTGTACGGCGACAACATTCCGGAGGAGCTGCTGCAGCGAGCGAAGCGCCAGCGCGAAGCTCAGGATGCGCTGACGCTGACGAACATGCTGCGCACCCCTACACCGGGCCAGACGTCGAACGCGCTGCAGAACGATCTCGACCCTCGAGCCCTCATCAAACTCAAGAGCTGGAACGGGCATTAG
  • Q65517916: Property:P370: ATGTCCGTTGCCTTGGAGTCGCTTCTGCACCGATCCGTGTGCTGCCACCTGGCACACGGTGAGGAGTACCGAGGCCAGCTGGAGGCCCTGGACGGCACCTTCGATGTGGTCCTGTCGCAGTGCACGCGGAGCCGCGCCGCCCCAAGGCAGCCGGCCGAGCCCCTCGTTTTTCTGCGCGGCGAGAACATCATCTACATCGGCTTCGACGAGTCGTCCAGAAGTGAGGACGGGACCACCGCGTGA
  • Q65518515: Property:P370: ATGGGAGGCTGCTGCGGGGTCGCCTCAGAGGCAGGCACGGCCTCGTACAACGACACGGTCTCTTCCACACCATTTCCACCACCGTCACGTCGCGGAAGGTGGCGGGGCTCAACAAGAAGCACCAGCAAGAACGAAAAAGCAGCGCTTAAGAGGAGTGGTAGGCTCGAGTCCGCGCCGTCGTTCCTGGGCAAGATACTACCGCTGAAGGATCGAGGTGACACCGACAGCGCTCCTACCCGCGGCACCGCCGTCGATGCCGTTCCCTCGGCCGCCCCTTTGAAGCTCAGCGATTACGCCACTCTCGCCGCCCCCGAACATGACCAGGACCTGCCTTTCAAAGCCACACCACAGCACGGCGCCAACGGCAGCAGCCCTGACCCGCTCCTGCCTGACCTGTTTTACATCTCCGCTTCCTCGTCCTCATCGCTTCTCGCGAACTGCGACGTGGACGATAGCGCTGAGGACGGCGTTGGCGCCCGTCTTGACGGTGAAGGGCAGAGCTCGCTGGTGGAGGTGAGCCAGCCAACGCAGAGCTTCGCAGGTGATGTGCACACGTACTCGGAGCTGGACTTGACGAGCGAGTGGGAGCCGCCGTCGTTCGATCGCCTTGGCCGGCGGTCGGAGCGTCTGGGCCGCAACGGAACGGACCGCAGCCGACTGCGTCAGCTGATCGTCCGCGAGGCCGAGGTGCGCGCGTCCCTGACGGTCATGTACGTGCATCAGCATCAGCGGTTTTCGCTGAACCTCGCCAAGGAGCACTTCATCGCGGTATACATTAGAATGCGGCAGGAGTACGAGTCGGAGTGGACGGTGCAGTGCATCTGCTGGATCGTTGCGGTAGAGAGTGTCATGCGGGAAGCGCTGGCACGCGAGTGGTGGACGGAGCGAGCCGCTTTAGTGCGCCGAGTCGGGTCTCTCAGGACGCCACCGCCACCACCACTGCGGCCGACGTGCGACGACGCGAGGCTGGGTATCACAGCCATTCACGCACTGAAGCGAGAGGACAGCTTGCCTTACGTATCGAACTTGTACACGGCCGCGGACTTGACCTCCAGCGAGGAGGCAGAGGAGGGCGACCCGCTGAACCTGTGCATCCCGCCCATGCGCGCCTCTTCCTCAATCGCCCTCTTCTCCCCACCGCTGCAGCAGCAGCTCTCGGTGCTTGGCGGATCGCGATCTGCCTCTGCAGGAGTGTCTCGCGGCCTTCGCTCGGCTTCTCGAGTTAGCGCACCACATGCCTCGTCTTTTGTGTCGTCGCCAGCATCGGCCCTTTACTCGCCTGTGCCGACGAAGCGCGTAGCCGCTGCGCAGCAGGCACAGAAGGGCAGGTTCGTGCGGGGGCGGAGCATGGCTGTTACCGAGGCGCTCCTGTGA
  • Q65521701: Property:P370: ATGTACAACGGTGTGGAAGCTGCCGCGGTCAAGGGTACCGGGCTGAGTGGCTATGTTCAGCGCAGCCGCGTGAACGTGTTGGCGACGGGCCGCGTGCCTGCCGAGGAGGGCGCGGCGGCGATGGAGGGCGGGGCGTCCATCAACCCCCTCGAGCAGCGCCGCGCACAGGGCGAGAACCGCGAGATGGCGGCACGGCTTGAGTCTCATCGCGCCTTGCGTGAGGTGCGACTGCGCGTCATGCTCTACCGTGAGGAGCGCGAGGCGGCCGGGGTGGACCCCGTCACAATGGACCGCGAGTGCGGCGAGCTCTACGACTCCTTGCTCGTCGCCGCCAAGCGCCGGCTGAAGGCGCAGCAGAAGACTGAGAACGCCAAGACAGTCGCTAAGTTCGCCGCCGCGTTCGGCGTGAAGGCCACGGCAGCGGTGACCACCTCAGGTGGTGGTGCAGGTAGCGGCAGCGCCTTCGACCGCTCCGTGCAGGAGGTGGAGAAGCACCGCACCGAGGAAGAGCGCCGCCGTCACCAGGAGGCGCAGCTCGTCGAGCACCTGAAGCGTATGCGCCGCGAGGGCAGCGACGCAGTAGAGGGTGCGAACATCTGCGACACAGAGGAGACAGGGATTTAG
  • Q65643840: Property:P370: ATGTACCGCACGGCGCCTCAGATTCTCTTTCAGTTTGTGGGTGGCCTGAGCATCACCCAGTACACCTACCCCATCCTCTACGACGCCTTCACTGGCGAGAAGACCGGTGCCCATGCCGCCACTATCACCACGTCCAGCAGCAGCGGCAGCTTCTCGGGGCTGTGGGGCAGCTTGAAGTGGAGCTTTCAAGCCCCTCCAGTGGATCACACCCTCACAGACGACATCGAGGAACTCCTGCGCACCCACTACTGGCTCGCGTCCGCAGTCCTGTCGCTCACGGTAGTGTCTGGCGGCGCGCCAGCGCTGCTAGGGAGCGGGCTCAGCGTGTACTGCAACGGCGGCCCCGAGGGCAAGGCCCGCTACTCCCTGCTGAAGCAGCGGCTTCGCAACTTCTCCGAGAATGGCAATCACGCATAA
  • Q65645685: Property:P370: ATGCCTCAAAATGCGGCGCAGCTGAACCGGATGCAGATTCGTGAGCAGGAGGCGCTCAACCGGCAGCGCCGCATGCAGGACGACGCGGTGGCACGGCGCGAGGAGGAGGAACTGCGGCGGACAAAGGCCCAATACGACCACGTCAGCTCGCACGGCTACGGACGAGCTGGCAGTGGTGCCGCTGCGCCGAGTGGCAGCCGTGGCGCATCCGACGAGGTGCAGATTCGCGTGTACGTGCGGGAGTGCGACGAGGAGGCGAGCCGGTCCTTCAGCTACCGAGAGGATACCGCTGCTAACTCCACCTCCCACATAGGTCCGCGTTCCGGTGCGTCTGCATCCACGTCGGCCGCTTCGCATGTCGCCAGACGTGGTGTCAACGGCGCGCTGCCACCGATTGGCTCGTCGGGGCGTCTTGGGCCACCGCGCGCGCCAGGGGCCCGTGCGGCGTCCGGCGGTGGTGGCGGCACTTCGGACATCTCAGGTGGTGCGGCATCATGTGGGGTGGTCGCACCGAACCGGGCACGGGTTCCTCGATACCTGCAGCAACGCAAGGCAGAGCTGGCGGCAGAGAAGGAGGCGATCGCCGCAGAGGCGGAGAAGCAGCGGCAACTTTCTCTCATCCCTGCTGGTCAGCGCCGCGTTTCGGAGGAGGAGAAGGCAGACACCCTGCGCCAGCTGGACGAGCGGCAGCAGGAGCTGGAGGGACAGCTGGCCCGCATTCCCATCCGCTTCGACACGCAGTCGATCCAGCAGCGGCGGCGCGCCATCGAGGAGGAACTGCGGCAGATCGAGACGACACGCAACAAGTACAACACCAAAGGGACTCTCTTCATGCCGCTGTGCTAG
  • Q65924744: Property:P370: ATGCGGCGCCTCTTCCTGCTGCTGGCATGGCAGCCATCCTTTGTCAAGCATCTCTCGGAACTGGAGCCGGCGCCGCAGAGAGCGCCCGTAGAGAAGCGACGTAGACAACATATCCCGCTCTCTCTGCAGGCACGCGAGGAGCTGTCCCGCAAGTCGAATGAGCTGCAGTACCATGTCGTCACGCAGGACTGGTTCGGCCAGCGCGTGGATGACTTCGTTATGCAGCACCACCCGGAGTGGGACTACGAGACGGTGAAGCGGCTGGTGCAGCAGGGGCACATCTACCGCTACCGGAAAAACGGAAAGAAGCGATACACGCGGCTGACGGATCGTCTGGAGTTCGATGAGCTTGTCGTCGTGCCGACAGCGAGCTTCTGGGAACGCCAGCTGGCGCCGCCGAGCGGGGTGGAGCTGCAGAGCTCCTCGACGTCGCAGCAGCAGGAGCGGCGGCAGAAGTTTCACCTCTCCGCCAAGACGCGCGAGATGGCGCAGGAGATGGTGCTCTTCAAGAACGAGCACGTCATCGTGATCAACAAGCCGAGCGGCGTGCCGATCATGCCGACGCACGACCCTCTTGCCATGAACATCACAGACCTCCTTCCGGCGTGGCGGTACACTAATACGCAAAAACCGGTCATATGCCACAACCTTGACACCGAGACGAGCGGGTGCGTGGTGCTGGCGCGCAGTGCGAACGCGCACCGCATGCTGGGCCGCATGTTTGTGAAGCGTGTAGTGCCGAACAGCGTGTACTGGGGTTTCGCGGTAGGGAAGCCGCCAGTGAATTTCGGCCGCATTCGCATGCACTTCGAGATTCAGAAGGGGCAGGGCGGCGATGTCATTGTTGCTCGCCCCACCCCCACCGCAGACTCCAAGGTAGGCATCGCCGAGTTCGTTGTGAATGCCTCCGCGCTGGAGTTCGGCAGCTTCATCTCCTTTTACCCACTGACGACGCGGCGGCATCAGGAGCGCATTATGGCCGCCCACGCGCTGCGAGCCCCGCTCCTTGGCGACGCGAAGTATGGTGGCGAGAGCGCCTTCCCGCACTCCCTGTCGCTCTTCTGGGACCCCGCCCGCAAAGACGTCCCACTGCACCTCCATCACCGCAAGATTCAGCTCCCCTACAAGAACGGCGCCGGTGAGTTTGTGTGCGTCACGGCGCCGCTGCCGCCGCACATGGAGAAGACGTTCAAGCGGTTGGGGTGGCCAGTCGACGCTGATGACCCACTTATCCCTGGTTGA
  • Q65924753: Property:P370: ATGTCCACATACGACAAATCAGATCAGATCGGCTATGATGAGACGGATAATACGTTGAATGCCGAGCTGGAAGAAATGATGGCGCGCACCCCACCGGAGGTGCAGCGCCACCTGCAGCACCGCATTCATGATGGCATCCTGCAGCGCATGAAAGAGGAGACGACACGCAAGTGCATTACGTTCATCCAAAAGTATGAGCAGTGTGTGAACAGCCAAAAGCCGTACAACATGAAGCTATGCTATCCCCACCGGGATGCTATGAATGGGTGCGCGCAGGAGGTTAACCGGGAGGAAAACTACCAACGTTACCGCATCATGTACCTCCGTGGCGAGCTGCTTAGGTACCATGAGAAACGTATTGCCGGCAAGATGGAGGCATTCAAGGTGAAGGCTCCCGACGCGATCCGTGGGTGGAAGCACGACTACGCACCCAAGTATATGCACATGATGGAGGATTTGGGGGCGGCGCCTCTCGGCAATGCCGTGGGGACGGCGGAGGAAACCACAAACTCGAAGTAG
  • Q65924767: Property:P370: ATGGCCCGTGGCAACCAGCGTGATCTCGCGCGGGAGAAGAACATGAAGAAGCAGCAGCAGAAGAACAAAGGTCACCGCGAGGACGGTCTTTCCCACGCTGCGCGCAGAGAGGCGGATGCCGAGGCGATGCGTCTGAAGCAGGCCGCTGCTGCGGAGCGGAAGGCTGCCGGAGGCTCGTGA

INSEE municipality code (P374): Item located in the administrative territorial entity (P131)[edit]

space launch vehicle (P375): Single value[edit]

Mérimée ID (P380): Item located in the administrative territorial entity (P131)[edit]

Mérimée ID (P380): Item country (P17) = France (Q142)[edit]

PCP reference number (P381): Item located in the administrative territorial entity (P131)[edit]

PCP reference number (P381): Item heritage designation (P1435) one of class A Swiss cultural property of national significance (Q8274529), class B Swiss cultural property of regional significance (Q12126757)[edit]

CBS municipality code (P382): Item located in the administrative territorial entity (P131)[edit]

CBS municipality code (P382): Item country (P17) one of Netherlands (Q55), Kingdom of the Netherlands (Q29999)[edit]

CBS municipality code (P382): Item coordinate location (P625)[edit]

CBS municipality code (P382): Unique value[edit]

soundtrack release (P406): Type work (Q386724), group of works (Q17489659)[edit]

Libraries Australia ID (P409): Format[edit]

Libraries Australia ID (P409): Unique value[edit]

military rank (P410): Contemporary[edit]

voice type (P412): Type human (Q5), fictional character (Q95074), role (Q1707847)[edit]

position played on team / speciality (P413): Type human (Q5), fictional human (Q15632617)[edit]

field of this occupation (P425): Conflicts with industry (P452)[edit]

taxonomic type (P427): Value type taxon (Q16521), type (Q3707858)[edit]

dantai code (P429): Item located in the administrative territorial entity (P131)[edit]

dantai code (P429): Single value[edit]

German municipality key (P439): Format[edit]

German municipality key (P439): Type municipality of Germany (Q262166), unincorporated area in Germany (Q15974311)[edit]

German district key (P440): Item located in the administrative territorial entity (P131)[edit]

German district key (P440): Item country (P17) = Germany (Q183)[edit]

German district key (P440): Item coordinate location (P625)[edit]

China administrative division code (P442): Format[edit]

astronaut mission (P450): Inverse[edit]

astronaut mission (P450): Value type manned spacecraft (Q7217761), spaceflight (Q5916), fictional spacecraft (Q14637321)[edit]

Emporis building ID (P455): Format[edit]

Emporis building ID (P455): Type architectural structure (Q811979), statue (Q179700)[edit]

sRGB color hex triplet (P465): Format[edit]

Eight Banner register (P470): Single value[edit]

country calling code (P474): Format[edit]

FilmAffinity ID (P480): Single value[edit]

FilmAffinity ID (P480): Unique value[edit]

OMIM ID (P492): Format[edit]

ISO 4217 code (P498): Format[edit]

HURDAT identifier (P502): Format[edit]

HURDAT identifier (P502): Unique value[edit]

BNCF Thesaurus ID (P508): Format[edit]

academic degree (P512): Type human (Q5), fictional character (Q95074), person (Q215627)[edit]

Find A Grave memorial ID (P535): Format[edit]

Find A Grave memorial ID (P535): Type person (Q215627), conjoined twins (Q216866), horse (Q726), animal (Q729), pig (Q787), orca (Q26843), Gorilla (Q36611), horned lizard (Q288720), Pan troglodytes (Q4126704), group of humans (Q16334295), cenotaph (Q321053), fictional human (Q15632617), memorial (Q5003624)[edit]

Find A Grave memorial ID (P535): Unique value[edit]

office contested (P541): Contemporary[edit]

officially opened by (P542): Target required claim sex or gender (P21)[edit]

officially opened by (P542): Value type human (Q5)[edit]

version type (P548): Scope[edit]

public username (P554): Scope[edit]

doubles record (P555): Single value[edit]

crystal system (P556): One of[edit]

crystal system (P556): Value type crystal system (Q898786)[edit]

singles record (P564): Single value[edit]

basionym (P566): Single value[edit]

publication date (P577): Conflicts with instance of (P31)[edit]

IPNI author ID (P586): Type human (Q5)[edit]

MMSI (P587): Single value[edit]

MMSI (P587): Type watercraft (Q1229765), radio communication station (Q1474493), sea mark (Q7321258), Maritime Rescue Coordination Centre (Q56885501)[edit]

point group (P589): One of[edit]

GNIS ID (P590): Format[edit]

ChEMBL ID (P592): Single value[edit]

MedlinePlus ID (P604): Format[edit]

conflict (P607): Conflicts with instance of (P31)[edit]

mother house (P612): Type monastery (Q44613)[edit]

OS grid reference (P613): Item country (P17) one of United Kingdom (Q145), Isle of Man (Q9676), Guernsey (Q25230), Kingdom of England (Q179876)[edit]

UTC date of spacecraft launch (P619): Single value[edit]

time of spacecraft orbit decay (P621): Type spacecraft (Q40218)[edit]

cultural properties of Belarus reference number (P632): Format[edit]

cultural properties of Belarus reference number (P632): Single value[edit]

ISTAT ID (P635): Format[edit]

ISTAT ID (P635): Single value[edit]

Léonore ID (P640): Format[edit]

Léonore ID (P640): Item sex or gender (P21)[edit]

Léonore ID (P640): Item date of birth (P569)[edit]

Léonore ID (P640): Unique value[edit]

Freebase ID (P646): Conflicts with instance of (P31)[edit]

drafted by (P647): Value type sports organization (Q4438121)[edit]

Biografisch Portaal van Nederland ID (P651): Type human (Q5), group of humans (Q16334295), fictional human (Q15632617)[edit]

Biografisch Portaal van Nederland ID (P651): Unique value[edit]

RTECS number (P657): Format[edit]

Mouse Genome Informatics ID (P671): Unique value[edit]

eMedicine ID (P673): Format[edit]

ÚSOP code (P677): Type natural monument (Q23790), protected area (Q473972), remarkable tree (Q811534)[edit]

ZVG number (P679): Unique value[edit]

NCBI taxonomy ID (P685): Single value[edit]

BHL Page ID (P687): Format[edit]

replaced synonym (for nom. nov.) (P694): Value type taxon (Q16521), scientific name, published under a Code of nomenclature (Q23729754), scientific name (Q10753560)[edit]

PubMed ID (P698): Allowed qualifiers[edit]

PubMed ID (P698): Conflicts with instance of (P31)[edit]

PubMed ID (P698): Conflicts with found in taxon (P703)[edit]

Strunz 8th edition (series ID, updated) (P711): Format[edit]

Strunz 8th edition (series ID, updated) (P711): Single value[edit]

Nickel-Strunz '10th ed', review of (9th ed/ 2009 update) (P713): Item IMA status and/or rank (P579)[edit]

JPL Small-Body Database ID (P716): Single value[edit]

Canmore ID (P718): Unique value[edit]

OKATO ID (P721): Allowed qualifiers[edit]

OKATO ID (P721): Format[edit]

Digitale Bibliotheek voor de Nederlandse Letteren author ID (P723): Unique value[edit]

Internet Archive ID (P724): Format[edit]

service retirement (P730): Conflicts with instance of (P31)[edit]

family name (P734): Conflicts with instance of (P31)[edit]

pseudonym (P742): Format[edit]

  • Q353758: Joan Almirall, Rosa María Almirall, Clifford Brawn, Clifford Brown Jr., Clifford Brown, Juan G. Cabral, Betty Carter, Candy Coster, Terry De Corsia, Rick Deconinck, Raymond Dubois, Chuck Evans, Toni Falt, Dennis Farnon, Jess Franck, J. Franco, James Franco, Jesse Franco, Jess Franco
  • Q353758: A.M. Frank, Adolf M. Frank, Antón Martín Frank, Jeff Frank, Wolfgang Frank, James Gardner, Manfred Gregor, Jack Griffin, Robert Griffin, Lennie Hayden, Frank Hollman, Frank Hollmann, Frarik Hollmann, B.F. Johnson, J.P. Johnson, Yogourtu Ungue, James Lee Johnson, James P. Johnson
  • Q353758: David J. Khune, D. Khunne Jr., D. Khunne, David J. Khunne, David Khunne, David Kuhne, David Kunne, David Kühne, Lulu Laverne, Lulú Laverne, Franco Manera, J. Franck Manera, J. Frank Manera, Jesús Manera, Jeff Manner, Roland Marceignac
  • Q353758: A.L. Mariaux, A.L. Marioux, John O'Hara, Cole Polly, Preston Quaid, P. Querut, Dan L. Simon, Dan Simon, Dave Tough, Pablo Villa, Joan Vincent, Robert Zinnermann
  • Q63644859: Ка—ров; К—ров, М. А.; Каров, М. А.; М. А. Каров; Мак—Ар; Макар; Менакер; Неон; Спартак; Шева—бен—Бихри; Rosch—Lokisch

pseudonym (P742): Type human (Q5), fictional character (Q95074), group of humans (Q16334295), individual animal (Q26401003)[edit]

Lake ID (Sweden) (P761): Item coordinate location (P625)[edit]

Lake ID (Sweden) (P761): Single value[edit]

Lake ID (Sweden) (P761): Type body of water (Q15324), waterbody (Q1389310)[edit]

Czech cultural heritage ID (P762): Item country (P17) = Czech Republic (Q213)[edit]

Czech cultural heritage ID (P762): Unique value[edit]

Swiss municipality code (P771): Item locator map image (P242)[edit]

INE municipality code (P772): Single value[edit]

INE municipality code (P772): Unique value[edit]

Swedish urban area code (P775): Unique value[edit]

Church of Sweden parish code (P778): Item Swedish National Archive ID (P5324)[edit]

Church of Sweden Pastoratskod (P779): Single value[edit]

LAU (P782): Single value[edit]

spore print color (P787): One of[edit]

International Standard Identifier for Libraries (P791): Conflicts with Mérimée ID (P380)[edit]

International Standard Identifier for Libraries (P791): Format[edit]

International Standard Identifier for Libraries (P791): Unique value[edit]

located on linear feature (P795): Value type railway line (Q728937), road (Q34442), transport network (Q924286), watercourse (Q355304), canal (Q12284)[edit]

student (P802): Value type human (Q5), fictional character (Q95074), Primates (Q7380)[edit]

Italian cadastre code (P806): Format[edit]

Italian cadastre code (P806): Single value[edit]

IUCN protected areas category (P814): One of[edit]

CGNDB Unique ID (P821): Item located in the administrative territorial entity (P131)[edit]

CERO rating (P853): Type video game (Q7889), expansion pack (Q209163), video game compilation (Q16070115)[edit]

BMLO ID (P865): Unique value[edit]

State Water Register Code (Russia) (P884): Single value[edit]

State Water Register Code (Russia) (P884): Type body of water (Q15324)[edit]

FIPS 10-4 (countries and regions) (P901): Unique value[edit]

PORT film ID (P905): Unique value[edit]

PEGI rating (P908): One of[edit]

PEGI rating (P908): Type video game (Q7889), expansion pack (Q209163), video game compilation (Q16070115), video game remake (Q4393107), software (Q7397)[edit]

USK rating (P914): Type video game (Q7889), expansion pack (Q209163), video game compilation (Q16070115), mobile app (Q620615), software (Q7397)[edit]

filming location (P915): Item instance of (P31)[edit]

LEM ID (P920): Format[edit]

FishBase species ID (P938): Unique value[edit]

ISIN (P946): Format[edit]

RSL ID (person) (P947): Allowed qualifiers[edit]

RSL ID (person) (P947): Format[edit]

MycoBank taxon name ID (P962): Single value[edit]

MycoBank taxon name ID (P962): Unique value[edit]

Austrian municipality key (P964): Item instance of (P31) one of district of Vienna (Q261023), statutory city of Austria (Q262882), municipality of Austria (Q667509)[edit]

e-mail address (P968): Format[edit]

category combines topics (P971): Type Wikimedia category (Q4167836)[edit]

MusicBrainz area ID (P982): Conflicts with MusicBrainz place ID (P1004)[edit]

MusicBrainz area ID (P982): Conflicts with MusicBrainz label ID (P966)[edit]

Philippine Standard Geographic Code (P988): Unique value[edit]

record held (P1000): Scope[edit]

Nationale Thesaurus voor Auteurs ID (P1006): Format[edit]

Vatican Library ID (P1017): Format[edit]

Vatican Library ID (P1017): Unique value[edit]

legal citation of this text (P1031): Unique value[edit]

Sycomore ID (P1045): Unique value[edit]

Catholic Hierarchy person ID (P1047): Unique value[edit]

NCL ID (P1048): Format[edit]

PSH ID (P1051): Conflicts with instance of (P31)[edit]

NLM Unique ID (P1055): Unique value[edit]

CVR number (P1059): Item instance of (P31)[edit]

Thailand central administrative unit code (P1067): Single value[edit]

rector (P1075): Conflicts with instance of (P31)[edit]

rector (P1075): Value type person (Q215627), fictional human (Q15632617), fictional humanoid (Q28020127), fictional character (Q95074)[edit]

ICTV virus ID (P1076): Format[edit]

KOATUU identifier (P1077): Item country (P17) = Ukraine (Q212)[edit]

population (P1082): Conflicts with point in time (P585)[edit]

population (P1082): Integer[edit]

maximum capacity (P1083): Integer[edit]

EUL editions (P1084): Format[edit]

Mohs' hardness (P1088): Range[edit]

redshift (P1090): Type astronomical object (Q6999), celestial event (Q751989)[edit]

gross tonnage (P1093): Units[edit]

orbital eccentricity (P1096): Range[edit]

orbital eccentricity (P1096): Type astronomical object (Q6999), spacecraft (Q40218), fictional astronomical object (Q15831598)[edit]

floors above ground (P1101): Range[edit]

floors above ground (P1101): Units[edit]

number of platform tracks (P1103): Range[edit]

number of platform tracks (P1103): Type transportation stop (Q548662)[edit]

number of episodes (P1113): Integer[edit]

number of episodes (P1113): Units[edit]

number of participants (P1132): Integer[edit]

floors below ground (P1139): Type construction (Q811430)[edit]

topic's main Wikimedia portal (P1151): Conflicts with instance of (P31)[edit]

topic's main Wikimedia portal (P1151): Inverse[edit]

topic's main Wikimedia portal (P1151): Value type Wikimedia portal (Q4663903)[edit]

Scopus EID (P1154): Format[edit]

US Congress Bio ID (P1157): Single value[edit]

CODEN (P1159): Type periodical (Q1002697)[edit]

municipality code (Denmark) (P1168): Item located in the administrative territorial entity (P131) one of Southern Denmark (Q26061), North Denmark Region (Q26067), Capital Region of Denmark (Q26073), Central Denmark Region (Q26586), Region Zealand (Q26589)[edit]

municipality code (Denmark) (P1168): Item list of monuments (P1456)[edit]

municipality code (Denmark) (P1168): Item instance of (P31) = municipality of Denmark (Q2177636)[edit]

municipality code (Denmark) (P1168): Item topic's main category (P910)[edit]

Rodovid ID (P1185): Single value[edit]

Rodovid ID (P1185): Type person (Q215627), fictional character (Q95074), narrative entity (Q21070598)[edit]

MEP directory ID (P1186): Unique value[edit]

bodies of water basin category (P1200): Single value[edit]

bodies of water basin category (P1200): Type body of water (Q15324)[edit]

bodies of water basin category (P1200): Unique value[edit]

bodies of water basin category (P1200): Value type Wikimedia category (Q4167836)[edit]

Wikimedia portal's main topic (P1204): Type Wikimedia portal (Q4663903)[edit]

Wikimedia portal's main topic (P1204): Unique value[edit]

Riksdagen person-ID (P1214): Single value[edit]

apparent magnitude (P1215): Type astronomical object (Q6999)[edit]

Internet Broadway Database show ID (P1219): Format[edit]

U.S. National Archives Identifier (P1225): Format[edit]

Openpolis ID (P1229): Format[edit]

JSTOR journal code (P1230): Type periodical (Q1002697)[edit]

Box Office Mojo film ID (P1237): Single value[edit]

OmegaWiki Defined Meaning (P1245): Format[edit]

OmegaWiki Defined Meaning (P1245): Unique value[edit]

patent number (P1246): Format[edit]

KulturNav-ID (P1248): Format[edit]

KulturNav-ID (P1248): Unique value[edit]

Swedish Open Cultural Heritage URI (P1260): Format[edit]

Rundata (P1261): Unique value[edit]

NNDB people ID (P1263): Format[edit]

NNDB people ID (P1263): Single value[edit]

facet of (P1269): Entity types[edit]

CANTIC ID (P1273): Format[edit]

Dictionnaire du Jura ID (P1276): Single value[edit]

Legal Entity Identifier (P1278): Unique value[edit]

OSM tag or key (P1282): Conflicts with coordinate location (P625)[edit]

OSM tag or key (P1282): Format[edit]

filmography (P1283): Allowed qualifiers[edit]

godparent (P1290): Value type human (Q5), fictional human (Q15632617), narrative entity (Q21070598)[edit]

Association Authors of Switzerland ID (P1291): Item country of citizenship (P27)[edit]

DNB editions (P1292): Format[edit]

number of elevators (P1301): Integer[edit]

number of elevators (P1301): Type geographical object (Q618123), geographic location (Q2221906), vessel (Q16391167)[edit]

instrument (P1303): Type human (Q5), fictional character (Q95074), group of humans (Q16334295), instrumentalist (Q1278335), house cat (Q146)[edit]

Swiss parliament ID (P1307): Unique value[edit]

EGAXA ID (P1309): Format[edit]

EGAXA ID (P1309): Unique value[edit]

has facet polytope (P1312): Type polytope (Q747980)[edit]

OpenCorporates ID (P1320): Unique value[edit]

MusicBrainz instrument ID (P1330): Single value[edit]

MusicBrainz instrument ID (P1330): Unique value[edit]

PACE member ID (P1331): Single value[edit]

coordinates of northernmost point (P1332): Single value[edit]

coordinates of southernmost point (P1333): Single value[edit]

coordinates of easternmost point (P1334): Single value[edit]

coordinates of westernmost point (P1335): Single value[edit]

territory claimed by (P1336): Type geographical object (Q618123), geographic location (Q2221906)[edit]

Italian Chamber of Deputies dati ID (P1341): Format[edit]

Italian Chamber of Deputies dati ID (P1341): Single value[edit]

Italian Chamber of Deputies dati ID (P1341): Unique value[edit]

number of victims of killer (P1345): Units[edit]

AlgaeBase URL (P1348): Unique value[edit]

number of matches played/races/starts (P1350): Units[edit]

Monte Carlo Particle Number (P1360): Type fermion (Q44363), boson (Q43101)[edit]

ITTF table tennis player ID (P1364): Single value[edit]

Art UK artist ID (P1367): Unique value[edit]

LNB ID (P1368): Format[edit]

Iranian National Heritage registration number (P1369): Single value[edit]

IHSI ID (P1370): Type Administrative territorial entity of Haiti (Q1779026)[edit]

ASI Monument ID (P1371): Unique value[edit]

capital of (P1376): Conflicts with instance of (P31)[edit]

Index Fungorum ID (P1391): Unique value[edit]

convicted of (P1399): Type human (Q5), group of humans (Q16334295), fictional character (Q95074), organization (Q43229)[edit]

FCC Facility ID (P1400): Type broadcaster (Q15265344)[edit]

Cycling Archives cyclist ID (P1409): Single value[edit]

Cycling Archives cyclist ID (P1409): Unique value[edit]

Oxford Dictionary of National Biography ID (P1415): Format[edit]

orbits completed (P1418): Scope[edit]

taxon synonym (P1420): Item taxon name (P225)[edit]

GRIN URL (P1421): Unique value[edit]

template's main topic (P1423): Type Wikimedia template (Q11266439)[edit]

OpenPlaques subject ID (P1430): Unique value[edit]

takes place in fictional universe (P1434): Value type fictional universe (Q559618), mythology (Q9134), literary cycle (Q867335), fictional location (Q3895768)[edit]

Jewish Encyclopedia ID (Russian) (P1438): Single value[edit]

image of grave (P1442): Type human (Q5), fictional human (Q15632617), individual animal (Q26401003), group of humans (Q16334295), human who may be fictional (Q21070568), burial plot (Q1541002)[edit]

number of missing (P1446): Units[edit]

list of monuments (P1456): Item country (P17)[edit]

list of monuments (P1456): Value type Wikimedia list article (Q13406463)[edit]

Cadw Building ID (P1459): Item heritage designation (P1435) one of scheduled monument (Q219538), Grade I listed building (Q15700818), Grade II* listed building or structure (Q15700831), Grade II listed building (Q15700834)[edit]

Cadw Building ID (P1459): Unique value[edit]

NIEA building ID (P1460): Item located in the administrative territorial entity (P131)[edit]

NIEA building ID (P1460): Single value[edit]

Post-Reformation Digital Library author ID (P1463): Single value[edit]

FIFA player ID (P1469): Unique value[edit]

Commons Creator page (P1472): Type human (Q5), organization (Q43229), group of humans (Q16334295), notname (Q1747829), workshop (Q656720), corporation (Q167037), person (Q215627)[edit]

Commons Creator page (P1472): Unique value[edit]

Gertrude identifier (P1529): Item coordinate location (P625)[edit]

family name identical to this given name (P1533): Conflicts with instance of (P31)[edit]

UBERON ID (P1554): Format[edit]

Executive Order number (P1555): Single value[edit]

Executive Order number (P1555): Type United States executive order (Q1338798)[edit]

zbMATH author ID (P1556): Single value[edit]

given name version for other gender (P1560): Conflicts with instance of (P31)[edit]

given name version for other gender (P1560): Symmetric[edit]